Skip to main content

Table 5 Primer sequences used in real-time PCR expression analysis for B. thermophilus SSH libraries validation

From: Molecular identification of differentially regulated genes in the hydrothermal-vent species Bathymodiolus thermophilus and Paralvinella pandorae in response to temperature

Genes Primer sequences
Elongation factor beta For: 5' GATCTTAAAAGTAAAGCTGGTCAGCAAGC 3'
  Rev: 5' AACAAATCAAAATCATCATCATCACCGCC 3'
Ribosomal protein L3 For: 5' AGATATATCGTATTGGAGAGGGATACCACACC 3'
  Rev: 5' GCTGTTGCATCCTTCTTCAATGGACCCAT 3'
Foot protein For: 5' AATAATGGTAAATGTGTTGCTAATGGCTA 3'
  Rev: 5' CCGTATCCCCTTCTACAACATCTACCGCC 3'
Pedal retractor myosin For: 5' AGAACCGACGAATTGGAAGAGGCCAAGAG 3'
  Rev: 5' AACAATTCAGCAGAGTAACTGCGGGCCTC 3'
Adhesive plaque matrix For: 5' AAAAGATGTGAAGTAAACAGATGCAGCCCA 3'
  Rev: 5' CCGTATCCCCTTCTACAACATCTGCCGCC 3'
Actin For: 5' ACGCGGGTCAGGGTCGGACGTAGCCACGC 3'
  Rev: 5' ATGGAGATCAGACGGAGATGGTCCTCCTC 3'
Adenosylhomocysteinase For: 5' GTAAATCTTGGTTGTGCTCATGGTCATCC 3'
  Rev: 5' GATTTGAATGGTCCTTCTTTAGGTAGACC 3'
Cyclophilin S For: 5' TTGAATAAAGCCAGATGGATGGATGGAAA 3'
  Rev:5' AAATCTTCATCGCTAGCTGCTTGTGCTTC 3'
Arginine kinase For: 5' ATGGGTGAAGTAGCAGAATTGTGGGCTAA 3'
  Rev: 5' TCACATGCATACAATCCGACTCCGCT 3'
Glutathione peroxidase For: 5' ATGGGCATAAACTTGGGAGACATTTT 3'
  Rev: 5' CCTAATTCTGTTGTACAAACAGGGGTATA 3'
BthermEST1 For: 5' AGTGACTTCACAACTGCCCGTATGTGGAA 3'
  Rev:5' TTGGTGCACATCATCAAGAAGGAGAGTAT 3'
Kalicludine For: 5' CCATGCAATGAAGATTGTCTTTTGCCAAA 3'
  Rev: 5' TTTGGCAAAAGACAATCTTCATTGCATGG 3'
Defensin For: 5' ATGTTCAAAGTAACTTTGTTCTTCGTTGG 3'
  Rev: 5' TACGATCTGCAGTGACACACGTTATG 3'
SPARC For: 5' AACGCAGACGACCACCGTACAGACGC 3'
  Rev: 5' TATGCATCACACTTGTCTGTAATGTCAACC 3'
Δ5-desaturase For: 5' AACGACTGGTTTACAGGGCATCTAAA 3'
  Rev: 5' TTTAGATGCCCTGTAAACCAGTCGTT 3'
Carbonic anhydrase-2 For: 5' GATGACAAGGAAGGATCTGAGCACACTCT 3'
  Rev: 5' AGAGTGTGCTCAGATCCTTCCTTGTCATC 3'
HSP90 For: 5' ATGCCTGAACCTGAAACAACTATGGATGA 3'
  Rev: 5' GAATACATCTGGGAATCTGCAGCTGGTGG 3'
Myc homolog For: 5' TCTGTTTATGATGCCTGGGTCACTCC 3'
  Rev: 5' GGAGTGACCCAGGCATCATAAACAGA 3'
Cytosolic malate dehydrogenase For: 5' ATGGCAGTTCCTTCAGATGGATCTTA 3'
  Rev: 5' CAATACACAAAAACAGACACTGTATACAT 3'
Techylectin 5A For: 5' GGATATCAGGGTAATGCAGGAGATGC 3'
  Rev: 5' GCATCTCCTGCATTACCCTGATATCC 3'