Skip to main content

Table 6 Primer sequences used in real-time PCR expression analysis for P. pandorae irlandei SSH libraries validation.

From: Molecular identification of differentially regulated genes in the hydrothermal-vent species Bathymodiolus thermophilus and Paralvinella pandorae in response to temperature

Genes Primer sequences
Intracellular hemoglobin For: 5' CTTGCCGATAACATTACTGCTGTTCGAGG 3'
  Rev: 5' TCGGCATCACCCGCCTTCTCCGCTACGTC 3'
Hemoglobin A2c For: 5' GTTCTGATCATAATCGCTGTCTGTCTGG 3'
  Rev: 5' TGTAGAAGCTGGGCATTCAGCGTGTCGGG 3'
Linker L1 For: 5' ATCATGGCAGGCCTGGTGGCACTCGCCAT 3'
  Rev: 5' TCTGATCCGTCATGACAGTCGTTAGCACC 3'
Linker L2 For: 5' ATGGTTGACGATGAGATGGACTTGATGGA 3'
  Rev: 5' ATCTTATAGCTGTCTATAGTAACCCG 3'
Hemoglobin B2 For: 5' CTGGATCATCTCGGCCGTCAGCATGTTGT 3'
  Rev: 5' GTGTGGTCGAGACGCGTTGCTCGGTCCGC 3'
PpandEST 2 For: 5' CAACCATGTGCCTACTTTACCTTGTTCAG 3'
  Rev: 5' AAGAACAGCTGCTGCAGAATATCTCCCAC 3'
Xylan endohydrolase For: 5' GAGATGGAAGAGAGAAATCCAGATTGGCT 3'
  Rev: 5' AGTTTCGCCTTCGAGTCACCGCTGTAGGC 3'
Rab 7 For: 5' CTTATTCAAGCTAGCCCACGAGATCCAGA 3'
  Rev: 5' CAACTCTCCGCTGAAGTCTTCGCCCGGTC 3'
Adenosylhomocysteinase For: 5' ATTGTGTGCAATATTGGACATTTTGACTGTGA 3'
  Rev: 5' AGACCTAAATAGCCAGCCTGGTCATCTGA 3'
Chymotrypsin For: 5' ACAGAGGTCGAATACGAGGTGATGACAAT 3'
  Rev: 5' ATGCCACCTGAGCTAAGAGTTCCCCATCC 3'
PpandEST 1 For: 5' GAAGCTGACCTAGCTTACGCCGGTCTGAA 3'
  Rev:5' TAGGGCTCGAGCGGCCGCCCGGGCAG 3'
Ribosomal protein S16 For: 5' GCTGTTGCTCACTGCAAACAGGGCAAAGGT 3'
  Rev: 5' TTGATCTCTTTCTTTGATGCTTCGTCGTC 3'
Nidogen secreted domain protein For: 5' CAATGCAAGTATTGGCCATGGCATGGTAG 3'
  Rev: 5' ACCCAGCGTCCTGCTTTGGCGACGTTACT 3'
Lipid binding protein For: 5' TTCAACATGTCTCAATTGAATGGGAAATGGAA 3'
  Rev: 5' TCCAGGCCCGTTTCGTTCACCTCGATACG 3'