Skip to main content

Table 2 Conserved Brachypodium miRNAs and their sequence similarity to known miRNAs from other plant species.

From: Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response

Name Sequence (5'-3') L
(nt)
Arm
/nt
Location Plant species
      Ara Pop Ric Whe
bdi-miR156a UGACAGAAGAGAGUGAGCAC 20 5'/123 super_2:28299658-28299677 ++++ ++++ ++++ ++++
bdi-miR156b    5'/123 super_2:28299895-28299914     
bdi-miR156c    5'/152 super_2:28300123-28300142     
bdi-miR156d    5'/112 super_5:10043111-10043130     
bdi-miR156e    5'/112 super_6:14734765-14734784     
bdi-miR156f    5'/186 super_8:656857-656876     
bdi-miR156g    5'/124 super_10:7252868-7252887     
bdi-miR160a UGCCUGGCUCCCUGUAUGCCA 21 5'/116 super_0:10869231-10869251 ++++ ++++ ++++ ++++
bdi-miR160b    5'/126 super_0:34912728-34912748     
bdi-miR160c    5'/129 super_3:8233739-8233759     
bdi-miR160d    5'/121 super_6:15675857-15675877     
bdi-miR162 UCGAUAAACCUCUGCAUCCGG 21 3'/133 super_5:10427165-10427185 +++ +++ +++  
bdi-miR164a UGGAGAAGCAGGGCACGUGCA 21 5'/186 super_0:24670885-24670905 ++++ ++++ ++++ +++
bdi-miR164b    5'/127 super_2:4986204-4986224     
bdi-miR164c    5'/161 super_2:12019567-12019587     
bdi-miR164d UGGAGAAGAAGGGCACAUGCA 21 5'/165 super_2:12019673-12019693 + ++ +  
bdi-miR166a UCGGACCAGGCUUCAUUCCCC 21 3'/222 super_0:8156180-8156200 ++++ ++++ ++++  
bdi-miR166b    3'/119 super_0:32809584-32809604     
bdi-miR166c    3'/108 super_1:32626519-32626539     
bdi-miR166d    3'/121 super_5:8578628-8578648     
bdi-miR166e    3'/148 super_8:6993194-6993214     
bdi-miR166f    3'/137 super_8:12758179-12758199     
bdi-miR166g UCGGACCAGGCUUCAUUCCUC 21 3'/115 super_12:6251912-6251932 +++ +++ ++++ ++
bdi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 5'/127 super_0:33041618-33041638 ++++ ++++ ++++ ++++
bdi-miR167b    5'/165 super_0:35725085-35725105     
bdi-miR167c    5'/122 super_12:1692366-1692386     
bdi-miR168 UCGCUUGGUGCAGAUCGGGAC 21 5'/101 super_6:17349865-17349885 ++ ++ ++++ ++++
bdi-miR169a AGCCAAGGAUGACUUGCCGG 20 5'/138 super_0:11730514-11730533 +++ ++ +++ +++
bdi-miR169b    5'/117 super_5:1266552-1266571     
bdi-miR169c UAGCCAAGGAUGACUUGCCUG 21 5'/129 super_5:16644104-16644124 ++++ ++ ++++  
bdi-miR169d    5'/138 super_5:16647089-16647109     
bdi-miR169e CAGCCAAGAAUGGCUUGCCUA 21 5'/112 super_7:4154045-4154066 + + + +
bdi-miR169f CAGCCAAGGAUGACUUGCCGG 21 5'/125 super_9:4769323-4769343 ++++ +++ ++++ ++++
bdi-miR171a UGAUUGAGCCGUGCCAAUAUC 21 3'/102 super_0:7984997-7985017 + + ++++ +
bdi-miR171b    3'/132 super_0:32458278-32458298     
bdi-miR171c    3'/130 super_1:34018204-34018224     
bdi-miR171d    3'/125 super_9:5726634-5726654     
bdi-miR172a AGAAUCUUGAUGAUGCUGCAU 21 3'/123 super_5:4196588-4196608 +++ +++ +++ +++
bdi-miR172b GAAUCUUGAUGAUGCUGCAU 20 3'/226 super_13:3713167-3713186 ++++ ++++ ++++ ++++
bdi-miR319 UUGGACUGAAGGGUGCUCCCU 21 3'/190 super_4:17219328-17219348 +++ ++ +++ +++
bdi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 5'/186 super_0:36774796-36774816 ++++ ++++ ++++ ++++
bdi-miR393 UCCAAAGGGAUCGCAUUGAUC 21 5'/125 super_9:7153943-7153963 +++ ++++ ++++ ++++
bdi-miR394 UUGGCAUUCUGUCCACCUCC 20 5'/172 super_5:7680773-7680792 ++++ ++++ ++++  
bdi-miR395a UGAAGUGUUUGGGGGAACUC 20 3'/90 super_1:16273497-16273476 +++ + ++  
bdi-miR395b    3'/89 super_1:16273342-16273323     
bdi-miR395c    3'/95 super_1:16272920-16272901     
bdi-miR395d    3'/143 super_6:4370549-4370568     
bdi-miR395e    3'/150 super_9:6484473-6484492     
bdi-miR395f    3'/96 super_9:6484650-6484669     
bdi-miR395g    3'/89 super_9:6484944-6484963     
bdi-miR395h    3'/76 super_9:6485096-6485115     
bdi-miR395i    3'/86 super_9:6485234-6485253     
bdi-miR395j    3'/88 super_9:6485371-6485390     
bdi-miR395k    3'/86 super_9:6485509-6485528     
bdi-miR395l    3'/96 super_9:6485786-6485805     
bdi-miR395m    3'/96 super_9:6486060-6486079     
bdi-miR395n    3'/90 super_9:6486197-6486216     
bdi-miR396a UCCACAGGCUUUCUUGAACUG 21 5'/161 super_0:1364119-1364139 ++ + ++++  
bdi-miR396b    5'/176 super_5:545413-545433     
bdi-miR397a AUUGAGUGCAGCGUUGAUGAA 21 5'/115 super_6:15909808-15909828 + + + +++
bdi-miR397b    5'/112 super_6:15937103-15937123     
bdi-miR398 UGUGUUCUCAGGUCGCCCCUG 21 3'/131 super_4:6919237-6919257 +++ ++++ ++++  
bdi-miR528 UGGAAGGGGCAUGCAGAGGAG 21 5'/119 super_1:34315939-34315959    ++++  
bdi-miR529 AGAAGAGAGAGAGUACAGCCU 21 5'/107 super_5:15162755-15162775   +++ +++  
bdi-miR827 UUAGAUGACCAUCAGCAAACA 21 3'/141 super_10:7087762-7087782 ++ ++ +  
  1. Name, the name of conserved Brachypodium miRNAs and underlines denote miRNAs whose miRNA* have been detected in Solexa sequencing analysis; Sequence, miRNA sequence cloned in the NC library and; L, the length of miRNA; Arm/nt, the miRNA location in the predicted hairpin structure (5' or 3' arm)/the length of the precursor; N, the number of loci in the genome for different miRNA families; Location, miRNA location in the genome; Ara, Arabidopsis; Pop, Populus; Ric, Rice; Whe, Wheat; For plus symbols in the table: ++++, miRNA sequences of Brachypodium were identical to those in other plant species; +++, miRNA sequences of Brachypodium were conserved in other plant species but have variations at 1 nucleotide positions; ++, miRNA sequences of Brachypodium were conserved in other plant species but have variations at 2 nucleotide positions; +, miRNA sequences of Brachypodium were conserved in other plant species but have variations at ≥ 3 nucleotide positions. For miRNAs whose homologs are not identified in rice, sequence comparison was only performed for the other four plant species.