Skip to main content

Table 4 Forward and reverse primer sequences used in semi quantitative RT-PCR analyses.

From: High-throughput sequencing and analysis of the gill tissue transcriptome from the deep-sea hydrothermal vent mussel Bathymodiolus azoricus

Candidate gene GenBank acc. no 5'-3' forward primer 5'-3' reverse primer
RECOGNITION    
Galectin HM756110 CTCCGGCGGGAGGGAATCCA AGTGGAAGCTGGGGTTCCGAGG
Carcinolectin HM756111 CGGATACAGTGGCACGGCAG TGATACCAACGAGCACCAGCAC
Aggrecan HM756112 TGCAAGCGGATACCCGGTAAA ATCAACGCAGAGTGGCCGAG
C-lectin HM756113 AGGCTTGGGATAGGCACATGGA ACGATTCACCCGAACAGAGTTGG
LBP/BPI HM756114 GCTTCACTGATACTGCTTGCCC CCACGGTGGAGCAGCATGGA
SRCR HM756115 TGATTCGATACCAAGGACCCAAAGGT TGTCAACTCCGGCTATTCCAGGT
PGRP HM756116 TCACACGGAAGGAGGAGCGT AGGGCTGCCTTGGATGGTGT
Thrombospondin HM756117 TGCTGCGACCCATTTCTGTGA GTGAGGAGTTCCACTGGTGAGGG
Rhamnose-binding lectin HM756118 ACAATGGGTTGATTTGTTTGCCGA CCGGGGGCCTGAAAGTTGGT
SIGNALING    
Lipoprotein receptor HM756119 CAGAGCCATCCACTTTGGCGG AGGTCTACACCTTCCAGCAGCA
Integrin HM756120 ACGGCCGGGGAGAAGTTGAA CGCAGTCACACGTTCCACAGAC
Serpin HM756121 AGGGTTGTGCGTGAAGTGGA TCTCAAAGCGAGGCTGCCAGA
α-macroglobulin receptor HM756122 CATTACGGCCGGGGCAAAGG TGCTGGCTCTCTCAGCTCGG
Tenascin HM756123 CATTACGGCCGGGGGTTGTA AGTCGGAACAGTCCTTTGGGT
EGF HM756124 GGGACACATTGCGAAACGGC TTGCCCCGTAAATCCAGGCA
GTPase HM756125 ATTACGGCCGGGGGACACAC TTCGGCATCCTGGCACTTCG
TNF factor HM756126 GGGATTAGGCAACACCCAAGCC CCGCCACAGTACAGCCAACC
VEGF receptor HM756127 AGCTGCATGGAGACTTGAACCAGA AGGTGGGGTGGTACTTGCTCC
Fas ligand HM756128 CGATTCGCTAGGACCGGGGA AGTCATTGGCGGTACTCCACACA
Toll HM756129 AGGAGGACTCGGATGACACAGC ACTCCGGAACTTGGAGAGCACG
MyD88 HM756130 CTGCCACACCCAACAACGCA TCGAGACTGAGGTTCTCGCACA
TRAF HM756132 CCCAACGACAGCCTTCTTTGACG ATTACGGCCGGGGGCTTGTT
IRAK HM756133 GAGTGGCCATTACGGCCGGG GCTTGCATCGATCTGGCGGGT
TRAF 6 HM756134 CACCTATTTCCGCTTCCCGCC TGGAGGGTGGTGGTGCTCTT
TRANSCRIPTION    
NF-κB HM756136 CCAAATGATGCACCTGCTCTTTTCAGT CATTACGGCCGGGGAAGGGA
Tal HM756137 GTTGACGCCATCGCTCTCGG GCCATTACGGCCGGGGTTTA
Jun HM756138 CGCCAACACCGACACAGTTCA AACCCCCGGGGAGTGTTGTT
AP-1 HM756139 TGCAGCTACACGGTTTCTGGC TCGGCAACAACACTCCCC
I-κB HM756140 TGAGGCAGCACTGAACGGAC CGCAGAGTGTGCCAACAGCA
STAT long form HM756141 ACGGCCGGGGTAAAGCTGAA ACAAATCCAGCCACATGCCCA
STAT (SH2 motif) HM756142 AGCGTCAAACACGACAGACGA AGACCACGCCCTGTTTCAGC
EFFECTOR    
Cytolysin HM756143 CGGTTGCTGTGTAGCCGCAT GGCGTCCAGAGACCGGAGTT
Glutathione peroxidase HM756144 TTAACGGCGTCGTCGCTTGG TGGCTTCTCTCTGAGGAACAACTG
TIMP HM756145 TGTCCCATGGGTCTGGAACGG TCAGCCTGTTCCTCTTGGCATT
Thiolester- macroglobulin HM756146 CTGGCTCTCTCAGCTCGGCA GGGCACTCTCCGGTCTTGGT
Metallothionein 1B HM756147 TCGGCACTGTCCACACAAAACC CAACCGGAAGCGGATGTGGC
Big Defensin HM756148 CCGGGGGCGATTGCCTTTC ACCAAGGCCCAAAATGCAGC
Defensin HM756149 AACGCAGAGTGGGCCATACG TCACTGGTGCGAACCGTTTGT
Ferritin HM756151 TCAACGCAGAGTGGGGCCAT GCGGTTCAGAAGTTGTTGTCACG
Catalase HM756152 CATGTTAGCAGGCACTCCAGACC TACGGCCGGGGGAAAAAGGT
  1. Based on sequences retrieved from the DeepSeaVent database, primers were designed to confirm, in RT-PCR experiments, the physical counterpart of B. azoricus genes putatively associated with immunity and inflammatory reactions.