Skip to main content


Table 2 Characteristics of 158 SSR markers in this study

From: Development of simple sequence repeat (SSR) markers from a genome survey of Chinese bayberry (Myrica rubra)

Locus GenBank Repeat motif Primer sequence (5'-3') Size range(bp)a Na Ho He PIC P HW
ZJU001ab JQ318696 (GA)10 F:<NED > <Tail-1 > CCTCTCCACCCATGAGAAAC 160-188 7 0.1667 0.4271 0.4002 0.0000
ZJU002ac JQ318697 (TC)13 F:<NED > <Tail-1 > TCAAAGAGACGTTGTGGCAG 219-229 4 0.2083 0.5257 0.4572 0.0005
ZJU003ab JQ318698 (AG)11 F:<NED > <Tail-1 > GTCACCTTGCTCTTCTTGGC 203-217 8 0.7407 0.8344 0.7949 0.0003
ZJU004ac JQ318699 (GA)10 F:<NED > <Tail-1 > AACAGAACCATCGTCAAGGC 204-210 4 0.3571 0.7325 0.6704 0.0003
ZJU005ab JQ318700 (AG)14 F:<NED > <Tail-1 > CTTTGGACATGGCAACACAC 200-228 11 0.3000 0.8679 0.8291 0.0000
ZJU006ab JQ318701 (GA)10 F:<NED > <Tail-1 > CTCGCCCTCTCTCTCTACCA 193-205 5 0.2593 0.3305 0.3089 0.0000
ZJU007ab JQ318702 (AG)13 F:<NED > <Tail-1 > TGATCCATTGGAACCATGTG 193-209 8 0.5625 0.6617 0.6302 0.1868
ZJU008ab JQ318703 (CT)10 F:<NED > <Tail-1 > GGAGAAATGAACGGTGGAGA 191-215 10 0.7931 0.7973 0.7563 0.0002
ZJU009ab JQ318704 (CT)10 F:<NED > <Tail-1 > AATTGTCGCAAGTAGTCGCC 207-221 5 0.0741 0.3599 0.3371 0.0000
ZJU010ab JQ318705 (CT)11 F:<NED > <Tail-1 > TGCAACATCGAAATTGGAAA 181-205 9 0.9032 0.8012 0.7614 0.0000
ZJU011a JQ318706 (GA)10 F:<NED > <Tail-1 > GGAGGCTCGTCAGTCATCTC 200-216 9 0.2692 0.7926 0.7554 0.0000
ZJU012ab JQ318707 (CT)12 F:<NED > <Tail-1 > CTTCACTCACCGCCTTTCTC 184-218 13 0.5000 0.8571 0.8251 0.0000
ZJU013ab JQ318708 (CT)10 F:<NED > <Tail-1 > ACTTGTCATTCCCACGTTCC 211-221 6 0.4444 0.5199 0.4515 0.0094
ZJU014ab JQ318709 (AG)15 F:<NED > <Tail-1 > TGGAATGTCGATCTGAAACAA 186-212 13 0.6875 0.9033 0.8791 0.0251
ZJU015ab JQ318710 (GA)11 F:<NED > <Tail-1 > TTGGTGTGGTGGTAATGGTG 199-221 6 0.6154 0.6614 0.5902 0.0585
ZJU016ab JQ318711 (TC)10 F:<NED > <Tail-1 > CCGTTGACTATTGCCCAGTT 196-216 11 0.6333 0.8469 0.8130 0.0179
ZJU017ab JQ318712 (CT)13 F:<NED > <Tail-1 > ACTGAAGAACCAAACGTGGG 180-200 6 0.6250 0.7093 0.6518 0.0003
ZJU018ab JQ318713 (CT)15 F:<NED > <Tail-1 > ACGAAATTTGACCAATCGCT 196-216 7 0.1429 0.7189 0.6667 0.0000
ZJU019ab JQ318714 (GA)12 F:<NED > <Tail-1 > TTTCATAACCCGTTGGCTTC 209-219 6 0.2800 0.6865 0.6317 0.0000
ZJU020b JQ318715 (AG)10 F:<NED > <Tail-1 > CACAGGACATGTGATGGAGG 201-213 7 0.5172 0.7453 0.6983 0.0000
ZJU021a JQ318716 (TG)10 F:<NED > <Tail-1 > TCGCCAGCTTCCTAATGTCT 190-212 8 0.7778 0.7428 0.7025 0.0663
ZJU022ab JQ318717 (GA)10 F:<NED > <Tail-1 > AAGCTTAAGCAAGCGTCGAG 188-208 9 0.6923 0.8575 0.8227 0.0109
ZJU023ac JQ318718 (AG)15 F:<NED > <Tail-1 > GTGTTTGGGCAGCACCTATT 200-226 14 0.6667 0.8840 0.8544 0.0251
ZJU024ab JQ318719 (TC)10 F:<NED > <Tail-1 > CCGCATGTTTGATTGATGTC 180-196 6 0.6000 0.7345 0.6716 0.1624
ZJU025ab JQ318720 (TC)10 F:<NED > <Tail-1 > TTTGAGCGATAGTACGGAGG 216-234 8 0.2667 0.7537 0.7044 0.0000
ZJU026ab JQ318721 (TC)10 F:<NED > <Tail-1 > CCAGACAGGTTAGCCACCAT 200-220 10 0.4545 0.8573 0.8199 0.0000
ZJU027 JQ318722 (TTC)8 F:<NED > <Tail-1 > GTTGCAATTTGCCTCCATTT 203-227 6 0.3125 0.6250 0.5321 0.0003
ZJU028ab JQ318723 (AG)10 F:<NED > <Tail-1 > CAACCATCCAAACCAAATCC 164-170 4 0.1724 0.2789 0.2566 0.0000
ZJU029ab JQ318724 (AG)10 F:<NED > <Tail-1 > TCTTCCGGGATGTCTACAGG 189-205 6 0.5312 0.6925 0.6296 0.0480
ZJU030ab JQ318725 (CA)13 F:<NED > <Tail-1 > AAGTGAGCTCTCCCTCCCTC 193-205 7 0.4286 0.7208 0.6676 0.0000
ZJU031ab JQ318726 (GA)16 F:<NED > <Tail-1 > GCACAGGAACACCAGGATCT 179-195 8 0.8387 0.7948 0.7492 0.0000
ZJU032ab JQ318727 (TC)11 F:<NED > <Tail-1 > ATTCCCACGTTCGTTCAGAC 204-226 8 0.6786 0.6442 0.5852 0.0220
ZJU033ab JQ318728 (TC)10 F:<NED > <Tail-1 > GCACAAGTTGCTGACATGCT 195-207 6 0.0690 0.6655 0.5897 0.0000
ZJU034ab JQ318729 (CT)10 F:<NED > <Tail-1 > ATGGGAATGTGGAGAACGAG 191-209 8 0.4138 0.7762 0.7250 0.0000
ZJU035ab JQ318730 (GA)14 F:<NED > <Tail-1 > TTGGATCCTGGTTACCTTCG 201-217 8 0.1290 0.7425 0.6900 0.0000
ZJU036ab JQ318731 (GA)10 F:<NED > <Tail-1 > CTGCCACTCTTACTGGCCTC 186-214 8 0.3333 0.5895 0.5516 0.0000
ZJU037ab JQ318732 (TC)10 F:<NED > <Tail-1 > GTGATTTCCCTCCCATTGAC 208-228 9 0.8125 0.7867 0.7429 0.0135
ZJU038b JQ318733 (AG)10 F:<NED > <Tail-1 > CTTATGGCCCGTTTGTAACC 194-200 4 0.2273 0.5106 0.4646 0.0007
ZJU039a JQ318734 (CT)10 F:<NED > <Tail-1 > AAACGAAAGTGGGCGTATTG 219-229 6 0.3077 0.6161 0.5745 0.0004
ZJU040 JQ318735 (TC)16 F:<NED > <Tail-1 > AAACTCCGTGCTGGAATCAA 198-220 10 0.3182 0.8192 0.7798 0.0000
ZJU041ab JQ318736 (TC)11 F:<PET > <Tail-2 > TGATCACCTTTCAGTTGGCA 226-244 5 0.2258 0.3199 0.3031 0.0000
ZJU042ab JQ318737 (TC)10 F:<PET > <Tail-2 > AGGATTTCTCCAGAGGGACG 220-242 5 0.3571 0.5331 0.4880 0.0000
ZJU043b JQ318738 (CT)10 F:<PET > <Tail-2 > AAACCGAGCTCTCCTAAGCC 225-245 4 0.5714 0.6383 0.5667 0.2655
ZJU044ab JQ318739 (GA)12 F:<PET > <Tail-2 > GATGGTGGCTTGTCTTGGTT 235-255 8 0.2500 0.5091 0.4853 0.0000
ZJU045ab JQ318740 (CT)10 F:<PET > <Tail-2 > GAGAGAGGGAGAGAGGCCAT 228-258 13 0.6129 0.8821 0.8544 0.0007
ZJU046ab JQ318741 (AG)10 F:<PET > <Tail-2 > TTGCTGTAAGCATCGCAATC 226-242 7 0.3871 0.6256 0.5824 0.0000
ZJU047ab JQ318742 (GA)13 F:<PET > <Tail-2 > TTCGATCATTCATGAGGCTG 247-259 7 0.7097 0.7615 0.7074 0.0019
ZJU048ab JQ318743 (CT)14 F:<PET > <Tail-2 > AGCGGACCGAGTTGTAGAGA 230-254 12 0.2903 0.8493 0.8166 0.0000
ZJU049ab JQ318744 (GAA)8 F:<PET > <Tail-2 > GTGTCTGCAGCAACTTCCAC 234-267 10 0.8125 0.7262 0.6797 0.0000
ZJU050ab JQ318745 (AG)11 F:<PET > <Tail-2 > GTCACAGCCTGGATAGCTCC 233-245 7 0.3000 0.7288 0.6916 0.0000
ZJU051ab JQ318746 (AG)12 F:<PET > <Tail-2 > AGAGAAAGACCGGGACCAAT 229-233 3 0.4333 0.4198 0.3594 0.0012
ZJU052ab JQ318747 (AG)16 F:<PET > <Tail-2 > CCCGAGCTGAACGAAATAGA 230-248 9 0.4348 0.8628 0.8261 0.0000
ZJU053ab JQ318748 (AG)10 F:<PET > <Tail-2 > AAATCCGAAACACCTCTCCC 222-240 8 0.5000 0.5655 0.5211 0.0001
ZJU054ab JQ318749 (CT)13 F:<PET > <Tail-2 > TTGATTTGCTTTGTGCATTTG 232-250 9 0.3000 0.8667 0.8268 0.0003
ZJU055ab JQ318750 (CT)10 F:<PET > <Tail-2 > TTATGGGTTTCATTGGGCAG 238-254 6 0.2500 0.7006 0.6357 0.0000
ZJU056ab JQ318751 (GA)13 F:<PET > <Tail-2 > GACAAAGTGGGTGCCATTCT 230-246 7 0.5714 0.7643 0.7122 0.0068
ZJU057ab JQ318752 (CT)10 F:<PET > <Tail-2 > TCATGTGGAGATTGAAGCCA 230-244 6 0.1579 0.6814 0.6283 0.0000
ZJU058ab JQ318753 (GT)10 F:<PET > <Tail-2 > TCCGGAGCTTTCAATCTCAT 252-274 11 0.7500 0.8274 0.7900 0.8036
ZJU059b JQ318754 (TC)14 F:<PET > <Tail-2 > TGTTTGTTTCTTGCTATTTCCATC 217-235 7 0.5200 0.7935 0.7505 0.0016
ZJU060ab JQ318755 (GT)8(GA)9 F:<PET > <Tail-2 > TGGCCAGGAACTTTGTATCC 223-243 7 0.6562 0.8110 0.7691 0.0000
ZJU061ab JQ318756 (TC)11 F:<PET > <Tail-2 > TTTGGAGGAAGCAAACAAGC 204-232 11 0.2812 0.7922 0.7506 0.0000
ZJU062 JQ318757 (TC)10 F:<PET > <Tail-2 > GTCGAGAGAACAAAGCGACC 240-252 7 0.2400 0.3282 0.3135 0.0004
ZJU063ab JQ318758 (TC)12 F:<PET > <Tail-2 > ACTCAGCAGGACCACCAACT 232-250 10 0.7000 0.8593 0.8270 0.1320
ZJU064b JQ318759 (GA)10 F:<PET > <Tail-2 > ACCATGAAGCTGACCTGGAG 226-244 6 0.4348 0.7256 0.6666 0.0001
ZJU065ac JQ318760 (CA)13 F:<PET > <Tail-2 > TCCAGAATATCATCTCTTGCCA 214-236 9 0.6333 0.7706 0.7219 0.0001
ZJU066ab JQ318761 (GA)10 F:<PET > <Tail-2 > CTTTCCCTTGTCGCTTTCAG 221-235 8 0.2593 0.6450 0.6075 0.0000
ZJU067ab JQ318762 (CT)10 F:<PET > <Tail-2 > CAGACAGCGAGGAGACAACA 217-263 11 0.6923 0.8273 0.7861 0.0070
ZJU068ab JQ318763 (CT)10 F:<PET > <Tail-2 > GAAGCTAAACGCCAGAAACG 227-239 6 0.2917 0.7535 0.6913 0.0000
ZJU069bc JQ318764 (GA)10 F:<PET > <Tail-2 > TGCCATAATCCTGAGAGCCT 224-258 8 0.2609 0.5594 0.5235 0.0004
ZJU070ab JQ318765 (CT)11 F:<PET > <Tail-2 > GTGCTCGAGATGTCCTCCAT 221-247 7 0.5200 0.7861 0.7364 0.0000
ZJU071ab JQ318766 (GA)10 F:<PET > <Tail-2 > CTAAGGTTGGTCCCTGTCCA 228-234 3 0.3704 0.6157 0.5305 0.0110
ZJU072ab JQ318767 (AG)10 F:<PET > <Tail-2 > AGTCAGCGTGGGAATGTACC 223-237 7 0.5625 0.7604 0.7117 0.0000
ZJU073a JQ318768 (AG)12 F:<PET > <Tail-2 > TACGCCAAGATCCAAAGACC 222-242 7 0.2105 0.7568 0.7087 0.0000
ZJU074ab JQ318769 (CT)15 F:<PET > <Tail-2 > TGCAGAGGAACTGGTGACTG 215-239 10 0.5517 0.8234 0.7831 0.0007
ZJU075b JQ318770 (CT)17 F:<PET > <Tail-2 > AATAAACACACAGGGCGAGG 239-255 9 0.0769 0.8650 0.8307 0.0000
ZJU076ab JQ318771 (AG)9 F:<FAM > <Tail-3 > ATGGTTACCGACGTCCTCTG 131-169 11 0.8438 0.8353 0.8034 0.0000
ZJU077ab JQ318772 (AC)9 F:<FAM > <Tail-3 > TTTGGAATTCAACAACATTTAGAC 137-153 8 0.2000 0.6590 0.6079 0.0000
ZJU078ab JQ318773 (TC)10 F:<FAM > <Tail-3 > ACACCACGGTTCTTCGATTC 130-146 6 0.5500 0.7513 0.6881 0.1339
ZJU079ab JQ318774 (TC)13 F:<FAM > <Tail-3 > AAGGCTAGACCGCAATCTGA 116-134 9 0.8438 0.8596 0.8291 0.0008
ZJU080ab JQ318775 (CT)9 F:<FAM > <Tail-3 > CTTGACGAAATGCAGACGAA 124-134 5 0.2903 0.3411 0.3172 0.0103
ZJU081ab JQ318776 (GA)8 F:<FAM > <Tail-3 > TGCTCTTGCAGAGAGTCGAG 137-157 6 0.5517 0.5820 0.5379 0.0003
ZJU082ab JQ318777 (CT)10 F:<FAM > <Tail-3 > TATATCGAATCCCAAAGGCG 129-141 5 0.3438 0.4043 0.3792 0.0169
ZJU083ab JQ318778 (AG)10 F:<FAM > <Tail-3 > TAGCCTTGGAGATTTAGGGC 133-157 11 0.8667 0.8960 0.8692 0.0000
ZJU084ab JQ318779 (AG)9 F:<FAM > <Tail-3 > TTTCGATTGGTGGTCTGTGA 124-138 6 0.1379 0.5197 0.4766 0.0000
ZJU085ab JQ318780 (AG)9 F:<FAM > <Tail-3 > GCTTTAACCGAGTGATGGGA 150-184 8 0.6875 0.5992 0.5383 0.6352
ZJU086ab JQ318781 (TC)10 F:<FAM > <Tail-3 > TCCTCTCTTTCACACTTCCGA 118-152 13 0.9062 0.8720 0.8445 0.0005
ZJU087ab JQ318782 (GA)9 F:<FAM > <Tail-3 > CGAGTGTAGCTAGGAACGGC 135-149 8 0.4688 0.7748 0.7273 0.0204
ZJU088ab JQ318783 (CT)9 F:<FAM > <Tail-3 > GAGCTCCGAACTTCTTCCCT 126-150 13 0.9677 0.8773 0.8490 0.0053
ZJU089ab JQ318784 (GA)8 F:<FAM > <Tail-3 > CGTTAGGATTCGGGAACAGA 138-152 7 0.8065 0.7382 0.6778 0.0000
ZJU090ab JQ318785 (AG)9 F:<FAM > <Tail-3 > GGAAATCTCCGAATGTGATCC 118-134 8 0.2903 0.6642 0.6089 0.0000
ZJU091bc JQ318786 (TC)15 F:<FAM > <Tail-3 > AAAGAGCACACAGCCCTAGC 124-146 10 0.4615 0.8695 0.8358 0.0012
ZJU092ab JQ318787 (TG)10 F:<FAM > <Tail-3 > CTCTTGCCGACCTCATTGTT 127-151 11 0.6875 0.8264 0.7916 0.0041
ZJU093ab JQ318788 (GA)10 F:<FAM > <Tail-3 > ATGCCATGTTGCATGAGTGT 130-156 12 0.9355 0.8662 0.8367 0.3689
ZJU094ab JQ318789 (CT)10 F:<FAM > <Tail-3 > ATCACGGGTTCTGCTGTTCT 124-150 10 0.9062 0.8646 0.8332 0.0000
ZJU095ab JQ318790 (AG)9 F:<FAM > <Tail-3 > TACCCACCGTACCAAAGGTC 114-130 7 0.4839 0.7070 0.6420 0.0004
ZJU096ab JQ318791 (CT)10 F:<FAM > <Tail-3 > CATACTGCAATGCATCTCCC 126-154 13 0.8000 0.8757 0.8479 0.0310
ZJU097ab JQ318792 (AG)10 F:<FAM > <Tail-3 > AATTGTTAGGGAGGGCTCGT 118-134 8 0.8438 0.7778 0.7297 0.0009
ZJU098ab JQ318793 (CT)9 F:<FAM > <Tail-3 > GACGCTCCATCTCTGGTCTC 145-167 10 0.9355 0.8831 0.8549 0.0483
ZJU099ab JQ318794 (GA)10 F:<FAM > <Tail-3 > TTGTTGCACTTGTGGGTGAT 130-150 9 0.7742 0.7763 0.7299 0.0000
ZJU100ab JQ318795 (TC)9 F:<FAM > <Tail-3 > ACTTGTCCGGATTCCACAAC 128-154 5 0.8333 0.6316 0.5629 0.2930
ZJU101ab JQ318796 (AG)9 F:<FAM > <Tail-3 > TGATTGAGCTGCCAACAAAG 134-154 7 0.6667 0.7062 0.6527 0.8110
ZJU102ab JQ318797 (GA)10 F:<FAM > <Tail-3 > GAACCACGAACTTCAACCGT 118-132 8 0.4231 0.5890 0.5441 0.0111
ZJU103ab JQ318798 (AG)9 F:<FAM > <Tail-3 > TGAGGAGGGAGTTGAGTTGG 121-139 10 0.7097 0.7731 0.7359 0.0003
ZJU104ab JQ318799 (TA)9 F:<FAM > <Tail-3 > ACGTGGCAGTTGAGTTGTTG 114-128 6 0.3704 0.6296 0.5702 0.1383
ZJU105ab JQ318800 (GA)11 F:<FAM > <Tail-3 > TGAGAAACGCAGCAAGAGAA 135-157 11 0.5806 0.8165 0.7801 0.0000
ZJU106ab JQ318801 (GA)8 F:<FAM > <Tail-3 > GCAGTCGGATAGAGAGACGG 134-146 7 0.3636 0.7717 0.7203 0.0000
ZJU107ab JQ318802 (TC)10 F:<FAM > <Tail-3 > TGGTGTCACGATTCACTGGT 114-130 8 0.4375 0.5322 0.5012 0.3632
ZJU108b JQ318803 (CT)9 F:<FAM > <Tail-3 > TTGGTAGTGCACTGCAGGAG 132-160 13 0.3929 0.8253 0.7909 0.0000
ZJU109ab JQ318804 (TC)10 F:<FAM > <Tail-3 > TCCGCTCTCCTCTCTGTCTC 138-164 11 0.8000 0.8441 0.8082 0.0003
ZJU110ab JQ318805 (AG)9 F:<FAM > <Tail-3 > TTGCACGGTGGTAGCTGTAG 143-159 5 0.7667 0.6486 0.5844 0.0000
ZJU111ab JQ318806 (TC)8 F:<FAM > <Tail-3 > TTTCTAATGTTGTTCGCCCA 122-136 5 0.9000 0.5701 0.4652 0.0000
ZJU112ac JQ318807 (GA)8 F:<FAM > <Tail-3 > GGAGAGTGAGAGATCGCAGC 133-147 8 0.4839 0.6557 0.6212 0.0009
ZJU113ab JQ318808 (AG)9 F:<FAM > <Tail-3 > AAACGCACCAGAGAAAGACG 138-154 6 0.6667 0.6588 0.5987 0.0130
ZJU114a JQ318809 (GA)10 F:<FAM > <Tail-3 > CTAGAGCGCTCCACGATACC 132-160 12 0.8214 0.8740 0.8448 0.0388
ZJU115ab JQ318810 (AG)14 F:<FAM > <Tail-3 > GGTCTGAGGCCTTCACTCTG 126-156 14 0.9677 0.9022 0.8775 0.0068
ZJU116ab JQ318811 (AG)15 F:<FAM > <Tail-3 > CTTTCTCCGTCTGCTCCATC 110-136 13 0.6875 0.8199 0.7846 0.0001
ZJU117ab JQ318812 (AAG)9 F:<FAM > <Tail-3 > TCTCAGATCCCTCCACGTTC 118-133 6 0.4688 0.6944 0.6426 0.0000
ZJU118ab JQ318813 (CT)9 F:<FAM > <Tail-3 > CAAGCCACGTGCATACCTATT 120-144 11 0.8750 0.8502 0.8171 0.0001
ZJU119a JQ318814 (AG)11 F:<FAM > <Tail-3 > CTTTCGACTTCAGAGGCAGC 136-152 9 0.4828 0.8348 0.7975 0.0000
ZJU120ab JQ318815 (GA)8 F:<HEX > <Tail-4 > TTGGTTTCGTTTGCAAGTCA 164-180 6 0.9355 0.7012 0.6354 0.0073
ZJU121a JQ318816 (CT)11 F:<HEX > <Tail-4 > AATCACCGAAGAAATCCACG 164-186 11 0.8621 0.8705 0.8426 0.0000
ZJU122ab JQ318817 (TC)8 F:<HEX > <Tail-4 > TGACGGAAGGATACTGGCTC 164-180 7 0.7742 0.7509 0.7012 0.0000
ZJU123ab JQ318818 (CT)8 F:<HEX > <Tail-4 > TGAATTATTCGGTTCCCTGG 172-176 3 0.4667 0.6367 0.5499 0.2152
ZJU124ab JQ318819 (CT)10 F:<HEX > <Tail-4 > GTGGCAGCCTCTCTATCGTC 161-187 12 0.9355 0.8778 0.8498 0.0001
ZJU125ab JQ318820 (TC)8 F:<HEX > <Tail-4 > TAAGGGCAGTCAGACCAACC 164-186 4 0.2188 0.3884 0.3453 0.0000
ZJU126ab JQ318821 (GA)10 F:<HEX > <Tail-4 > CCAATGTGGACAGGTGTGAG 173-193 11 0.9677 0.8535 0.8228 0.0000
ZJU127 JQ318822 (GC)10 F:<HEX > <Tail-4 > AGGATCCTTGTCACCACCAG 165-189 11 0.9259 0.8288 0.7900 0.0079
ZJU128ab JQ318823 (AG)14 F:<HEX > <Tail-4 > CCCAATTGACACAAATTCCC 145-161 5 0.4194 0.5019 0.4496 0.1981
ZJU129ab JQ318824 (CT)10 F:<HEX > <Tail-4 > GAGGTGCAATTACGTGGCTT 161-189 10 0.7500 0.8031 0.7611 0.0234
ZJU130ab JQ318825 (GA)8 F:<HEX > <Tail-4 > GATTGCATGCACCAAATCAC 160-176 5 0.3478 0.4599 0.4131 0.2852
ZJU131ab JQ318826 (CT)14 F:<HEX > <Tail-4 > TTGAGAATCACAAACGCCTG 153-187 13 0.8710 0.8990 0.8735 0.0009
ZJU132ab JQ318827 (CT)11 F:<HEX > <Tail-4 > AGGCACCTTTCTTTCCTCTC 164-178 5 0.6452 0.6568 0.5834 0.6586
ZJU133ab JQ318828 (TC)11 F:<HEX > <Tail-4 > GCCCTGCAGTCTTTGTCAAT 171-195 8 0.8710 0.7731 0.7267 0.0000
ZJU134ab JQ318829 (GA)11 F:<HEX > <Tail-4 > AGTGCCCAAGCATGACTTCT 172-190 8 0.9688 0.7907 0.7507 0.0004
ZJU135ab JQ318830 (AG)10 F:<HEX > <Tail-4 > AATTTACGGCTGTCCGTGAG 173-191 10 0.9688 0.7966 0.7557 0.0000
ZJU136ab JQ318831 (GA)10 F:<HEX > <Tail-4 > TCCCACAGATCTCTAGCCGT 173-201 13 0.7742 0.8953 0.8692 0.0004
ZJU137ab JQ318832 (TC)8 F:<HEX > <Tail-4 > TGGATCTTGCTGCAGTTGTC 140-168 12 0.1875 0.6930 0.6612 0.0000
ZJU138ab JQ318833 (CT)10 F:<HEX > <Tail-4 > GCACAGTTGAGTTATGGGCA 152-170 8 0.3333 0.7746 0.7261 0.0001
ZJU139ab JQ318834 (GA)12 F:<HEX > <Tail-4 > CCGAGCTTCGTTAGGACTTG 138-164 6 0.3667 0.4418 0.4043 0.0000
ZJU140b JQ318835 (CT)14 F:<HEX > <Tail-4 > TGTGCTCATCTTGGATCCTG 172-198 9 0.6538 0.6139 0.5474 0.0000
ZJU141ab JQ318836 (CT)13 F:<HEX > <Tail-4 > CACAATCAGCTGCAGAATCAA 175-201 11 0.6774 0.7996 0.7600 0.0002
ZJU142ab JQ318837 (TC)13 F:<HEX > <Tail-4 > CATTCACCTCCTTTCGCAAT 166-184 9 0.6774 0.6912 0.6498 0.0231
ZJU143ab JQ318838 (CT)12 F:<HEX > <Tail-4 > GTAGAGTAGATGCGCCTCGG 181-197 7 0.6923 0.7044 0.6397 0.0000
ZJU144ab JQ318839 (AG)12 F:<HEX > <Tail-4 > GCCACTCTTCCCTCAACGTA 148-164 7 0.5161 0.6864 0.6252 0.0430
ZJU145ab JQ318840 (CT)10 F:<HEX > <Tail-4 > TGTGGCTGTGTTCCTCCATA 155-175 7 0.6875 0.7351 0.6912 0.0000
ZJU146ab JQ318841 (AG)10 F:<HEX > <Tail-4 > TGGAAACTTTGTCGTGTGGA 154-168 6 0.2258 0.6663 0.6187 0.0000
ZJU147ab JQ318842 (AG)10 F:<HEX > <Tail-4 > TTAGGAACCAAACTGGACGG 173-195 10 0.8333 0.7169 0.6811 0.0005
ZJU148ab JQ318843 (AG)18 F:<HEX > <Tail-4 > AAGAGCAGGAACCGAACCTT 160-190 15 0.9375 0.9067 0.8829 0.4973
ZJU149ab JQ318844 (TC)8 F:<HEX > <Tail-4 > AGCCCTCCATGTGTGCTTAT 139-163 11 0.8333 0.8718 0.8417 0.0022
ZJU150ab JQ318845 (AG)10 F:<HEX > <Tail-4 > ACTTAACTGAGAGGCTGCGG 163-201 10 0.9000 0.8469 0.8123 0.0053
ZJU151ab JQ318846 (CA)9 F:<HEX > <Tail-4 > GAATTGGAAATCCCTAGCCC 156-170 6 0.3750 0.5511 0.5188 0.0001
ZJU152ab JQ318847 (AG)11 F:<HEX > <Tail-4 > AAACGAAGTCGTTCAATGCC 163-181 7 0.9355 0.7578 0.7040 0.0161
ZJU153ab JQ318848 (AG)10 F:<HEX > <Tail-4 > CCAGCTCCGAATTAGCAAAC 173-191 6 1.0000 0.6667 0.5927 0.0000
ZJU154ab JQ318849 (AG)11 F:<HEX > <Tail-4 > TTGTCAATTGCCCTTCCTTC 156-184 10 0.9333 0.6847 0.6184 0.0000
ZJU155ab JQ318850 (TC)9 F:<HEX > <Tail-4 > GAGAGCAATCAGTGAAGCCC 160-188 8 0.8438 0.6731 0.6037 0.0000
ZJU156ab JQ318851 (TA)8 F:<HEX > <Tail-4 > ATACGTCGAAAGATCCACCG 166-184 7 0.5484 0.6626 0.6063 0.0000
ZJU157ab JQ318852 (AG)9 F:<HEX > <Tail-4 > CACTCACAACCAAAGCCAGA 154-186 13 0.9677 0.9064 0.8823 0.0171
ZJU158ab JQ318853 (AT)10 F:<HEX > <Tail-4 > CCAGATGATCACGCAGCTTA 156-174 9 0.6452 0.8292 0.7917 0.0000
Mean 8.25 0.5636 0.7178 0.6730  
  1. Note: a b c These SSRs are transferable for M. adenophora, M. nana and M. cerifera, respectively. SSR markers are listed according to ascending order in different fluorescent dyes. Shown for each primer pair are the repeat motif, primer sequences, size range (bp), number of alleles detected (Na), observed heterozygosity (Ho), expected heterozygosity (He), polymorphism information content (PIC) and Chi-square test for Hardy-Weinberg equilibrium (PHW). The annealing temperature was 60 ° C; a, including length of tail sequences (18 bp total). PHW over 0.05 are underlined.