Transcriptome profiling of granulosa cells of bovine ovarian follicles during growth from small to large antral sizes

Table 5 Primers and conditions used for quantitative RT-PCR

Target	Primer sequences 5′-3′	Genbank accession number	PCR reaction and conditions
CYP19A1	Forward ggctatgtggacgtgttgacc	NM_174305	2 min 50C, 10 min 95C, 40 × cycles of 15 s 95C and 60 s 60C
	Reverse tgagaaggagagcttgccatg
CYP17A1	Forward accatcagagaagtgctccgaa	NM_174304	2 min 50C, 10 min 95C, 40 × cycles of 15 s 95C and 60 s 60C
	Reverse ccacaacgtctgtgcctttgt
18S	Forward agaaacggctaccacatccaa	DQ2224	2 min 50C, 10 min 95C, 40 × cycles of 15 s 95C and 60 s 60C
	Reverse cctgtattgttatttttcgt

ISSN: 1471-2164