The battle of the sexes starts in the oviduct: modulation of oviductal transcriptome by X and Y-bearing spermatozoa

Table 2 Primers used for qPCR analysis

Gene symbol	Affymetrix porcine probe	Primer	Sequence	Product size (pb)
CCL8	SSc.9957.1.A1_at	Forward	5′ GCGAGATGGCATTTCTCTCT 3′	119
CCL8	SSc.9957.1.A1_at	Reverse	5′ CACACTTCGGCTTACAAGAGG3′	119
IRF7	SSc.2573.9.1_S1_at	Forward	5′ GCTGGATGAAGCCAGAACA 3′	97
IRF7	SSc.2573.9.1_S1_at	Reverse	5′ GGCCCAGGCCTTAAAGAT 3′	97
Ubiquitin B	Reference gene	Forward	5′ GTCTGAGGGGTGGCTGCTAA 3′	85
Ubiquitin B	Reference gene	Reverse	5′ TGGGGCAAATGGCTAGAGTG 3′	85
β-actin	Reference gene	Forward	5′ CCTCCCTGGAGAAGAGCTA 3′	131
		Reverse	5′ CTTCATGATGGAGTTGAAGGT 3′

ISSN: 1471-2164