Skip to main content

Table 5 Sequences of primers used for genotyping BCMV resistance conferred by the I gene

From: Application of in silico bulked segregant analysis for rapid development of markers linked to Bean common mosaic virusresistance in common bean

Marker Primers (5′-3′) Physical position
SW13 marker CACAGCGACATTAATTTTCCTTTC Multiple hits in the genome
(Melotto et al., 1996) [36] CACAGCGACAGGAGGAGCTTATTA
KASP marker (without tail sequences),
BCMV_48289723_F CCCTAATTCACTTTCCGAGTAAGAGAAGC 48,289,632
BCMV_48289723_G TGAAAATGGGTCGGGTCGGAC 48,289,742
BCMV_48289723_A CTTGAAAATGGGTCGGGTCGGAT 48,289,744
CAPS marker
BCMV_48289723_CAPS AGGAGGAAGAACGGTGGTC 48,289,519
  TTTGGTGGTAATTTGAAAATGG 48,289,829