Skip to main content

Advertisement

Table 5 List of used primers, their temperature and MgCl optimum and length of product.

From: Gene expression in TGFbeta-induced epithelial cell differentiation in a three-dimensional intestinal epithelial cell differentiation model

name direction sequence size MgCl μmol annealing temp
GAPDH F ATG CCA GTG AGC TTC CCG TTC AGC 199 2 70
GAPDH R TGG TAT CGT GGA AGG ACT CAT GAC    
VRK2 F GCAGAAAGAGGAGAAACTGATTGGA 245 4 62
VRK2 R CCGTGCTGACTGTGGAAGTGTATT    
GM2A F TTCCTTGCCACTGTCCCTTCA 222 3 61
GM2A R CTTCCTCACACCGCTCCATTCT    
CRYAB F CCCCTTCTTTCCTTTCCACTCC 266 3 62
CRYAB R CACCTCAATCACATCTCCCAACAC    
DRPLA F GAACTCTCCCTAACCCCCTGCTT 279 3 63
DRPLA R GTGGCTTGTCGCTTTCCTTCTTC    
DIO2 F GGGCATCCTCAGCGTAGACTTG 295 4 64
DIO2 R GCCACTGTTGTCACCTCCTTCTGT    
PSMB F TATTTATTGTTGTGGTGCTGGGACA 350 4 65
PSMB R TCTTGGCTTCCTCCTCCTCCA    
ROK1 F CCTGTTCTTGTTTTTGTTCAGTCCA 298 3 61
ROK1 R TTGCTTTTCCCTTATTCCCTGCTC    
PLCG1 F CTCAACTTCCAGACCCCTGACAA 237 3 64
PLCG1 R CACCTCAATCTCCACAAAAGGACAC    
KRT19 F GCACCCTTCAGGGTCTTGAGAT 346 3 64
KRT19 R AAGACACCCTCCAAAGGACAGC