Skip to main content
Download PDF

No association of a Vascular endothelial growth factor A (VEGFA) gene polymorphism with pre-eclampsia among pregnant women in Uganda

BMC Genomics volume 24, Article number: 132 (2023) Cite this article

Abstract

Background

Vascular endothelial growth factor A (VEGFA) is a major angiogenic factor that plays an important role in the formation of blood vessels during embryonic development. VEGFA has been implicated in the pathophysiology of pre-eclampsia (PE), since pre-eclamptic women present with reduced levels of free circulating VEGFA. The 3’ untranslated region (3’-UTR) of the VEGFA gene consists of elements that regulate the transcription and hence expression of the VEGFA protein in circulation. Hence it is suggested that variations thereof could underlie the reduced VEGFA levels observed in pre-eclamptic women. The purpose of this study was to investigate presence of the + 936C/T polymorphism, a common single nucleotide polymorphism (SNP) in the 3’-UTR of the VEGFA gene, and determine its association with PE among pregnant women in Uganda.

Results

There was no significant difference observed in the allele and genotype frequencies of the + 936C/T 3’ UTR-VEGFA polymorphism between pre-eclamptic and normotensive pregnant women (P > 0.05). Additionally, there was no significant difference in the median plasma levels of free VEGFA among women with the wild type, CT and TT genotypes of the + 936C/T VEGFA polymorphism (median = 0.84 pg/mL (IQR = 0.39–1.41) Vs 1.05 (0.61–1.18) Vs 1.05 (1.05–1.05) respectively, p-value = 0.7161).

Conclusions

These study findings indicate that the + 936C/T 3’ UTR-VEGFA polymorphism had no significant association with increased susceptibility to PE among women in Uganda. Further studies with a larger sample size are recommended.

Peer Review reports

Background

Pre-eclampsia (PE) is a pregnancy complication that is diagnosed after 20 weeks of gestation in a previously normotensive woman, and is characterised by new onset of hypertension, and proteinuria [1]. PE is a major cause of fetal, new-born and maternal morbidity and mortality, affecting 5–7% of pregnant women worldwide [2]. The burden of PE is higher among women of African ancestry as evident by the high attributable maternal mortality rate in sub-Saharan Africa and among women of African ancestry elsewhere in the world [3, 4].

The pathogenesis of PE remains unclear, although vascular endothelial cell injury and dysfunction, and placental ischemia remain core features of the syndrome [5]. Vascular endothelial growth factor A (VEGFA) is a major angiogenic factor that facilitates endothelial cell differentiation, proliferation, migration and invasion, as well as regulates formation and development of blood vessels. VEGFA also plays a key role in trophoblast cell development and function, and is required during placental vascularization to enable sufficient supply of blood to the growing fetus [6]. In fact, reduced expression of VEGFA during placental and embryonic development can lead to embryonic deformities and death [7]. PE is accompanied with an aberrant balance of circulating angiogenic factors, including reduced bioavailability of free VEGFA which is linked to the vascular damage [8, 9]. Low VEGFA levels in pre-eclamptic women are partly attributed to excess release of soluble fms-like tyrosine kinase 1 (sFlt-1) from the placenta, which acts as a decoy receptor, binding free VEGFA in the maternal circulation [10].

Human VEGFA is encoded by the VEGFA gene located on the chromosome 6 p21.3, and consists of 8 exons and 7 introns within a coding region of 14 kb. The VEGFA gene is highly polymorphic with several single nucleotide polymorphisms (SNPs) detected in the untranslated and promoter regions [11, 12]. The 3’ untranslated region (3’-UTR) of the VEGFA gene consists of regulatory elements where binding of transcriptional factors (such as hypoxia induced proteins) effects changes in expression of VEGFA. It is hypothesized that variations within the 3’UTR of the VEGFA gene may result into individual differences in the expression and hence circulating levels of VEGFA [13]. A study by Renner et al. [13] identified a + 936C/T 3’ UTR-VEGFA polymorphism (rs3025039), a common SNP in the 3’UTR of the VEGFA gene, as associated with reduced circulating VEGFA levels. Indeed, in some studies, polymorphisms in the VEGFA gene were associated with dysregulated expression of VEGFA, leading to increased susceptibility to PE [13,14,15]. The + 936C/T polymorphism was later identified to increase susceptibility to PE among Korean women [16].

Currently in Uganda and the rest of sub-Saharan Africa, less is known about the + 936C/T 3’ UTR-VEGFA polymorphism and its association with PE. Uganda is faced with a high burden of PE, leading to about 6% of the 336 estimated maternal deaths per 100,000 live births per year [17]. Knowledge of genetic biomarkers could improve quality of antenatal care through better risk stratification and early screening of pregnancy complications including PE, hence reducing its burden [18, 19]. In this study therefore, we investigated the association between the + 936C/T 3’ UTR-VEGFA polymorphism and PE among women in Uganda.

Results

Baseline characteristics of study participants

The socio-demographic and clinical characteristics of the study participants are summarized in Tables 1 and 2 respectively. There was no significant difference in the maternal and gestational between cases and controls. All study participants were Black Africans by self-report, most of whom were married, and majority in the control group having attained up to secondary level education. The number of participants with a family history of PE, family history of hypertension, and diagnosis with hypertension in the previous pregnancy, was significantly higher among cases as compared to the control group (p-values; ˂0.0255, < 0.0034 and 0.0005 respectively).

Table 1 Socio-demographic characteristics of study participants
Full size table
Table 2 Clinical characteristic of study participants
Full size table

Association of the + 936C/T 3’ UTR-VEGFA gene polymorphism with susceptibility to PE

Among all study participants, 225 had the homozygous wild type variant of the + 936C/T SNP, whereas 24 were identified to be heterozygous (CT genotype), and one homozygous (TT genotype) (Fig. 1). To determine whether the + 936C/T 3’ UTR-VEGFA polymorphism is associated with susceptibility to PE, univariate and multivariate conditional logistic regression analysis was performed (Table 3). Clinical and demographic variables with a biological plausibility to PE, and those with p-value ≤ 0.2 in the univariate analysis were considered for multivariate analysis. These included; Alcohol consumption, family history of Diabetes mellitus, family history of PE, family history of hypertension, HIV status, diagnosis with hypertension in previous pregnancy, type of pregnancy and Marital status. Findings indicate that presence of the 936 T allele in the 3’UTR of the VEGFA gene is associated with about 2 times increased likelihood of developing PE, however this was not statistically significant (aOR, 1.78 (95% CI, 0.65–4.91), p-value = 0.2640). The number of participants with family history of hypertension was higher among cases as compared to controls across all genotypes of the + 936C/T polymorphism (Supplementary Figure S1). However, after Bonferroni correction, family history of hypertension was not significantly associated with PE (aP-value = 0.1109).

Fig. 1
figure 1

Distribution of the rs3025039 SNP variations among cases and controls. The number of participants with a + 936C/T (rs3025039) variation was higher among cases compared to controls. The wild group indicates participants with the wild type genotype of the rs3025039 SNP

Full size image
Table 3 Bivariate and multivariate analysis for association of the + 936C/T 3’ UTR VEGF gene polymorphism with PE
Full size table

Genotypes and allele frequencies of the + 936C/T 3’ UTR-VEGFA gene polymorphism between women with pre-eclampsia and the controls, and susceptibility to PE

We further investigated the genotype and allele frequencies of the + 936C/T 3’ UTR-VEGFA polymorphism, and their association to PE susceptibility (Table 4). All loci were in Hardy–Weinberg equilibrium in both the cases and the control group (P > 0.05). We observed a higher frequency of the T allele and the CT genotype of the + 936C/T polymorphism among cases compared to controls, however this was not statistically significant (p-values; 0.5465 and 0.2829 respectively). Only one individual among all study participants was identified as homozygous genotype TT for the 936C/T polymorphism.

Table 4 Comparison of genotypic and allelic frequencies of the + 936C/T 3’ UTR-VEGFA polymorphism among cases and controls
Full size table

Plasma VEGFA levels and the + 936C/T 3’ UTR-VEGFA SNP genotypes

Secondarily, we investigated the difference in the plasma levels of free circulating VEGFA by each of the + 936C/T SNP genotypes among the cases and controls (Table 5). The concentration of VEGFA was log transformed to the base of two prior to this analysis. A total of 180 samples were assayed for the concentration of free plasma VEGFA (including 122 cases and 58 controls), among which only 18 were found to have the + 936C/T SNP, 17 of which were heterozygous (CT genotype) and one homozygous (TT genotype). The concentration of plasma free VEGFA was significantly lower among the cases as compared to controls (median = 0.76 pg/mL (IQR = 0.39–1.18) Vs 1.02 pg/mL (0.44–1.62) respectively, p-value = 0.0616) (Fig. 2). Cases with the CC wild genotype had significantly lower VEGFA plasma levels as compared to controls with the same genotype (median = 0.8 pg/mL (IQR = 0.38–1.18) Vs 1.0 pg/mL (0.44–1.65) respectively, p-value = 0.0437). Among only samples with the CT genotype, the plasma levels of free VEGFA were higher among cases compared to controls. Median concentration of free plasma VEGFA was higher among individuals with the heterozygous and homozygous genotypes, as compared to those with the wild type +936C/T polymorphism. These findings however lacked statistical significance.

Table 5 Comparison of plasma VEGFA levels between genotypes of the + 936C/T 3’ UTR-VEGFA polymorphism
Full size table
Fig. 2
figure 2

Distribution of free circulating VEGFA plasma levels among genotypes of the + 936C/T polymorphism. A Logarithm of the median plasma levels of VEGFA in cases versus controls (All genotypes). B Logarithm of the median plasma levels of VEGFA among cases and controls with only the wild type CC genotype. C Logarithm of the median plasma levels of VEGFA among cases and controls with the CT and TT genotypes

Full size image

Discussion

Pre-eclampsia (PE) is a complex pregnancy complication with multiple genetic links [20]. VEGFA, a major angiogenic factor that regulates vascular formation and function, as well as placental development, plays a crucial role in the pathophysiology of PE [21]. Previously, various studies among pregnant women have indicated a decrease in plasma VEGFA levels as one of the features for PE [8, 22, 23]. Genetic mechanisms are suggested to underlie reduced expression of circulating VEGFA, implicating variations/mutations in the VEGFA gene [24]. In this study we describe the detection of the +936C/T polymorphism; a common SNP variation in the 3’ UTR of the VEGFA gene, and its association with susceptibility to PE. We further describe the plasma levels of free circulating VEGFA by each of the genotypes of the +936C/T polymorphism among both pre-eclamptic and normal pregnant women.

Our findings indicate that the + 936C/T 3’ UTR-VEGFA polymorphism was associated with about 2 times increased likelihood of developing, however this was not statistically significant. Hence, no significant association was found between the + 936C/T polymorphism and increased susceptibility to PE among the women attending Mulago National Referral Hospital in Uganda. We further observed no significant difference in the genotype and allele frequencies of the + 936C/T 3’ polymorphism between the cases and controls. Our findings are similar to a study done among Sinhalese women that indicated no significant difference in the genotype frequencies of the + 936C/T polymorphism among cases with PE and normotensive pregnant women. That is, there was no significant association between the + 936C/T 3’ UTR-VEGFA polymorphism and risk of developing PE [25]. However, contrary to our findings, a study by Shim et al. [16] found that carriage of the + 936 T allele was independently associated with increased susceptibility to PE among Korean women. The frequency of the + 936C/T 3’ UTR-VEGFA polymorphism among the Korean women was significantly higher among cases as compared to controls. In another study, the CT, CT + TT genotypes, and T allele of the + 936C/T were risk factors for pre-eclampsia in Sudanese women [26]. This inconsistency could be attributed to ethnic differences between the study populations, and environmental, immunological and lifestyle factors that interactively contribute to the multifactorial complex of the PE syndrome [27]. Other previous studies have similarly indicated a link between the + 936C/T 3’ UTR-VEGFA polymorphism and increased risk of developing PE in other populations such as Asians, Caucasians and Latinos [16, 28,29,30].

We further investigated the difference in the concentration of plasma free circulating VEGFA by each of the + 936C/T genotypes among the cases and controls. Overall, the pre-eclamptic women had significantly lower plasma free VEGFA levels compared to the control group. This is similar to findings from previous studies [8, 22, 31]. In this study, we found that participants with the CT and TT genotypes of the + 936C/T polymorphism had higher VGEF levels compared to participants with the wild type CC genotype, however, this difference was not statistically significant. Contrary to these findings, a study by Procopciuc LM et al., [32] indicated that carriers of the 936 T allele among mothers affected by PE had significantly reduced levels of circulating VEGFA. Presence of the 936 T allele is associated with reduced ability to upregulate VEGFA production hence enhancing development of PE [33].

Among other risk factors linked with susceptibility to PE in this study, multivariate analysis indicated that women with a family history of hypertension were more likely to develop PE in the current pregnancy. However, after correcting for multiple testing using Bonferroni correction, these findings were not statistically significant. Our findings then differ from previous literature that shows a strong link between family history of hypertension and PE. In a study by Bezerra et al. [34], the risk of developing PE was two times higher in a pregnant woman whose sister had an account of hypertension (OR 2.60, 95% CI 1.60–4.21, p < 0.001). The risk of developing PE was even higher (3 times) among pregnant women who had both a mother and sister with hypertension (OR 3.65, 95% CI 1.65–8.09, p = 0.001).

Still at multivariate analysis, we further observed a borderline association between family history of PE and susceptibility to PE, which was non-significant after correction for multiple testing. However, previously, it is well recognised that family history of PE is associated with increased likelihood of developing the syndrome in a current pregnancy [35, 36]. In a study done among women in Taiwan, mothers with a sororal history of PE similarly had a higher risk for pre-eclampsia compared to those without (relative risk; 2.6, CI; 2.41–2.80) [36].

Conclusions and recommendations

This is one of the few studies investigating genetic factors associated with PE among women in the Ugandan population. A previous study in this population revealed that a KIR 2DS5 gene locus was associated with protection against PE [37]. Identification of key genetic markers of PE is crucial especially among the highly burdened African populations which double with high genetic diversity.

In conclusion, there was no significant association between the + 936C/T 3’ UTR-VEGFA polymorphism and increased likelihood of developing PE, and no significant difference in the circulating free VEGFA levels by each of the genotypes of the + 936C/T polymorphism. Despite the fact that our sample size estimation was deliberate to afford 80% power of the study, we recommend a bigger sample sized study to ensure accuracy of these results. Nonetheless, we believe that our results increase the body of knowledge on factors associated with pre-eclampsia among women in Uganda.

Furthermore, the VEGFA gene has multiple variations, which warrants further studies targeting other SNP variations and their haplotype effect towards susceptibility to PE. And given the fact that PE is a heterogeneous syndrome with several genes implicated in its pathophysiology, investigations on how these multiple genes interact are much required towards defining the complex mechanism of PE and identification of genetic markers of susceptibility.

Methods

Study population and procedures

In this study, a matched case–control design was utilized to enroll pregnant women aged 18–42 years, at 20 or more weeks of gestation, from Mulago National referral hospital, Kampala, Uganda. Cases were defined as pregnant women presenting with new onset hypertension; including increased systolic blood pressure (BP) ≥ 140 mmHg and diastolic BP ≥ 90 mmHg measured on 2 occasions at least 4 h apart, and proteinuria ≥ + 1 on urine dipstick test [17]. Controls were defined as healthy pregnant women presenting with normal systolic BP ˂ 140 mmHg and diastolic BP˂ 90 mmHg on two occasions at least 4 h apart, with trace or negative urine protein. Controls were matched to identified cases by maternal and gestational ages at a ratio of 1:1 using the following categories; 18–22, 23–27, 28–32, 32–42 years, and 20–28, 29–33, 34–37, 38–43 weeks of gestation. These included a total of 125 women with PE as cases and 125 pregnant women without PE as controls, enrolled from the maternity ward and the outpatient antenatal clinics respectively, from March to October 2019. Women with confirmed fetal abnormalities and pre-existing pathologies (including; diabetes mellitus, cardiovascular disease, chronic renal disease), and those who had received blood transfusion in the previous 3 months were excluded from study participation.

Participant Interviews were conducted using a study designed data tool to obtain socio-demographic and clinical characteristics of study participants; including maternal and gestational age, marital status, level of education, social history (smoking and alcohol consumption), family medical history (diabetes mellitus, PE and hypertension) and personal medical history (HIV status, parity, type of pregnancy and diagnosis with hypertension in a previous pregnancy). Six milliliters (6 mL) of ethylenediaminetetraacetic acid (EDTA) anti-coagulated blood were collected from each study participant via the antecubital vein by a trained study midwife/nurse. Four milliliters (4 mL) of the blood sample were used to extract deoxyribonucleic acid (DNA). Platelet poor plasma was obtained from the rest 2 mL of blood sample using methods previously described [8].

Extraction of DNA

DNA extraction was done using the Qiagen whole blood DNA extraction kit (QIAamp DNA Blood Midi Kit), following the manufacturer’s instructions. Briefly, for each participant sample, designated kit buffers were mixed with the sample to lyse the blood cells, stabilize nucleic acids, and enhance selective DNA adsorption to the QIAamp membrane. Alcohol was added to the lysates which were thereafter loaded onto the QIAamp spin column. Wash buffers were used to remove impurities from the spin column QIAamp membrane, and pure ready-to-use DNA eluted in low-salt AE buffer. Extracted DNA was quantified using a nanodrop spectrophotometer (Thermo Scientific™ NanoDrop 2000c) and stored temporarily at -20 °C.

Polymerase chain reaction amplification, Gel electrophoresis and SNP Genotyping

DNA amplification was achieved using conventional polymerase chain reaction (PCR) assay, targeting a specific region within the 3’UTR of the VEGFA gene. Specific PCR primers were designed using the NCBI web-based primer BLAST tool as described by Jian Ye et al., [38]. The designed PCR primer sequences were synthesized by the Eurofins Genomics company (Eurofins Genomics AT GmbH, Viehmarktgasse 1B/Büro 2, 1030, Vienna, Austria), and these comprised the following sequences;

Forward, 5ˈ- TTTGTTTTCCATTTCCCTCAGAT -3ˈ.

Reverse, 5ˈ- CCAACTCAAGTCCACAGCAGTC -3ˈ—targeting a 545 bp product within the 3’ UTR of the VEGFA gene. Each PCR assay was performed in a 50 μL reaction volume containing 5 μL of genomic DNA (50-100 ng/μL), 1 μL of 10 mM Deoxynucleotide (dNTP) solution Mix (NEW ENGLAND BioLabs), 1.5 μL of each primer (10 pmol/μL), 0.125 μL of DreamTaq Hot Start DNA polymerase (5 U/μL, Thermo Scientific, Lithuania), 5 μL of 10X DreamTaq buffer (Thermo Scientific, Lithuania), and 35.875 μL of Nuclease free water. The PCR reactions were run on a conventional thermal cycler (BIO-RAD, T100 Thermal Cycler) using the following program; Initial denaturation at 95 °C for 3 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 62.2 °C for 1 min and extension at 72 °C for 1 min, then a final extension at 72 °C for 10 min and the holding step at 4 °C.

Detection of PCR products was achieved using gel electrophoresis on a 1.5% agarose gel (Fig. 3). Gel viewing was done using ultraviolet light in a UV transilluminator (UVP Biodoc-It Uv Transilluminator Imaging System).

Fig. 3
figure 3

PCR amplification of 3’UTR- VEGFA. Agarose gel electrophoretogram of a 545 bp sequence within the 3’UTR of the VEGFA gene amplified by PCR from different human samples

Full size image

The PCR amplicons were purified, and sequenced at ACTG Inc. (Wheeling II, USA). Sanger sequencing was employed to sequence the purified amplicons, using an ABI Prism 3100 Sequencer (Applied Biosystems, Foster City, CA, USA). All quality control samples had a 100% rate of agreement.

Plasma VEGFA assay

Assessment of plasma free VEGFA levels was done using Magnetic luminex performance assay (Human Angiogenesis Premixed Kit A; R&D Systems, a bio-techne brand), following by the manufacturer’s instructions. Analysis of Luminex data was done using Milliplex analyst software. Due to their unreliability, VEGF concentrations below 0.2 pg/mL (the border of reliability as suggested by the = Milliplex analyst software) were divided by the factor 2 in order to prevent spurious positive associations.

Inter-assay coefficient of variation was 10.03%. Part of the VEGFA results presented in this article have been published (8).

Data analysis

Sample size estimation

In reference to a study by Shim et al. [16], we assumed a probability of exposure of 15.1% to the + 936C/T 3’ UTR-VEGFA polymorphism among normotensive pregnant women in the control group, an odds ratio of exposure among the pre-eclamptic relative to the normotensive of 2.45 and 2% loss of samples, for a one control per case, at least 125 cases hence 125 controls are required to test the hypothesis that the odds ratio is equal to 1 considering power of 80% and 5% type 1 error probability associated with the test of the hypothesis. Sample size calculation was done using the epiR package [39].

Bioinformatics analysis

Using a sanger sequencing data analysis tool; tracy v0.5.9 [40], the reference human genome (GRCh37) was indexed. The obtained sample sequences were then aligned to the reference, variants called and annotated based on the GRCh37 human genome build. The resultant Binary Call Format (BCF) files were converted to Variant Call Format (VCF) files using bcftools v1.8 [41]. The variants were screened for the presence of the + 936C/T (rs3025039) variant using VCFtools v0.1.16 [42]. All this was done using customized bash scripts. Figure 4 indicates sequencing chromatographs showing the rs3025039 SNP mapped in the 3’ UTR of the VEGFA gene.

Fig. 4
figure 4

Chromatogram. Showing + 936C/T SNP mapped in the 3’UTR of the human VEGFA gene

Full size image

Statistical analysis

Categorical variables were summarized as absolute numbers and proportions. Continuous variables were summarized as medians and corresponding interquartile ranges. Mann–Whitney U-test was used to compare continuous variables and Fisher’s exact test or Chi-square test for comparing categorical variables. The association of the + 936C/T polymorphism with PE was explored using conditional logistic regression. All analyses were performed in R statistical programming environment version 4.0.5. Packages used for analysis include; survival for conditional logistic regression and ggplot2 for visualizing analysis results [43].

Availability of data and materials

The dataset supporting the conclusions of this article is included within the article (see Supplementary information file). The DNA sequence data generated and analysed during the current study is available in GenBank, accession numbers: ON777416—ON777792.

Abbreviations

aOR:

Adjusted odds ratio

BCF:

Binary Call Format

BLAST:

Basic Local Alignment Search Tool

BP:

Blood pressure

DNA:

Deoxyribonucleic acid

EDTA:

Ethylenediaminetetraacetate

HWE:

Hardy–Weinberg equilibrium

NCBI:

National Center for Biotechnology Information

OR:

Odds ratio

PE:

Pre-eclampsia

sFlt-1:

Soluble fms-like tyrosine kinase 1

SNP:

Single nucleotide polymorphism

UTR:

Untranslated region

VCF:

Variant Call format

VEGFA:

Vascular endothelial growth factor A

mL:

Milliliters

µL:

Microlitre

pg/mL:

Picogram per milliliter

3’:

Three prime

References

  1. Gupte S, Wagh G. Preeclampsia-eclampsia. J Obstet Gynaecol India. 2014;64(1):4–13.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Rana S, Lemoine E, Granger JP, Karumanchi SA. Preeclampsia. Circ Res. 2019;124(7):1094–112.

    Article  CAS  PubMed  Google Scholar 

  3. Nakimuli A, Chazara O, Byamugisha J, Elliott AM, Kaleebu P, Mirembe F, et al. Pregnancy, parturition and preeclampsia in women of African ancestry. Am J Obstet Gynecol. 2014;210(6):510-20.e1.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Say L, Chou D, Gemmill A, Tunçalp Ö, Moller AB, Daniels J, et al. Global causes of maternal death: a WHO systematic analysis. Lancet Glob Health. 2014;2(6):e323–33.

    Article  PubMed  Google Scholar 

  5. Vitoratos N, Hassiakos D, Iavazzo C. Molecular mechanisms of preeclampsia. J Pregnancy. 2012;2012:298343.

  6. Guo X, Yi H, Li TC, Wang Y, Wang H, Chen X. Role of Vascular Endothelial Growth Factor (VEGF) in human embryo implantation: clinical implications. Biomolecules. 2021;11(2):253.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Bosco C, Buffet C, Díaz E, Rodrigo R, Morales P, Barja P, et al. VEGF in the muscular layer of placental blood vessels: immuno-expression in preeclampsia and intrauterine growth restriction and its association with the antioxidant status. Cardiovasc Hematol Agents Med Chem. 2010;8(2):87–95.

    Article  CAS  PubMed  Google Scholar 

  8. Nabweyambo S, Sande OJ, McGovern N, Bwanga F, Ssekagiri A, Keesiga A, et al. Circulating levels of angiogenic factors and their association with preeclampsia among pregnant women at Mulago National Referral Hospital in Uganda. PLoS ONE. 2021;16(5): e0251227.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Humar R, Zimmerli L, Battegay E. Angiogenesis and hypertension: an update. J Hum Hypertens. 2009;23(12):773–82.

    Article  CAS  PubMed  Google Scholar 

  10. Palmer KR, Tong S, Kaitu’u-Lino TJ. Placental-specific sFLT-1: role in pre-eclamptic pathophysiology and its translational possibilities for clinical prediction and diagnosis. Mol Hum Reprod. 2016;23(2):69–78.

    Google Scholar 

  11. Vincenti V, Cassano C, Rocchi M, Persico G. Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3. Circulation. 1996;93(8):1493–5.

    Article  CAS  PubMed  Google Scholar 

  12. Takahashi H, Shibuya M. The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions. Clin Sci (Lond). 2005;109(3):227–41.

    Article  CAS  PubMed  Google Scholar 

  13. Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger E. A Common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vasc Res. 2000;37(6):443–8.

    Article  CAS  PubMed  Google Scholar 

  14. Duan W, Xia C, Wang K, Duan Y, Cheng P, Xiong B. A meta-analysis of the vascular endothelial growth factor polymorphisms associated with the risk of pre-eclampsia. Biosci Rep. 2020;40(5):BSR20190209.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Eddy AC, Bidwell GL 3rd, George EM. Pro-angiogenic therapeutics for preeclampsia. Biol Sex Differ. 2018;9(1):36.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Shim J-Y, Jun JK, Jung B-K, Kim SH, Won H-S, Lee PR, et al. Vascular endothelial growth factor gene +936 C/T polymorphism is associated with preeclampsia in Korean women. Am J Obstet Gynecol. 2007;197(3):271e1-.e4.

    Article  Google Scholar 

  17. (UBOS) UBoS, ICF. Uganda Demographic and Health Survey 2016. UBOS and ICF: Kampala, Uganda and Rockville, Maryland, USA; 2018.

  18. Kisuule I, Kaye DK, Najjuka F, Ssematimba SK, Arinda A, Nakitende G, et al. Timing and reasons for coming late for the first antenatal care visit by pregnant women at Mulago hospital, Kampala Uganda. BMC Pregnancy Childbirth. 2013;13(1):121.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Palomaki GE, Martin JN Jr, Karumanchi SA, Poon LC. Updates on screening, prevention, treatment, and genetic markers for preeclampsia. Clin Chem. 2018;64(12):1684–9.

    Article  CAS  PubMed  Google Scholar 

  20. Haram K, Mortensen JH, Nagy B. Genetic aspects of preeclampsia and the HELLP syndrome. J Pregnancy. 2014;2014: 910751.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Wang A, Rana S, Karumanchi SA. Preeclampsia: the role of angiogenic factors in its pathogenesis. Physiology. 2009;24(3):147–58.

    Article  PubMed  Google Scholar 

  22. Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF, et al. Circulating angiogenic factors and the risk of preeclampsia. N Engl J Med. 2004;350(7):672–83.

    Article  CAS  PubMed  Google Scholar 

  23. Tannetta D, Sargent I. Placental disease and the maternal syndrome of preeclampsia: missing links? Curr Hypertens Rep. 2013;15(6):590–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Choi SH, Ruggiero D, Sorice R, Song C, Nutile T, Vernon Smith A, et al. Six novel loci associated with circulating VEGF levels identified by a meta-analysis of genome-wide association studies. PLoS Genet. 2016;12(2):e1005874-e.

  25. Andraweera PH, Dekker GA, Dissanayake VHW, Bianco-Miotto T, Jayasekara RW, Roberts CT. Vascular endothelial growth factor family gene polymorphisms in preeclampsia in Sinhalese women in Sri-Lanka. J Matern Fetal Neonatal Med. 2013;26(5):532–6.

    Article  CAS  PubMed  Google Scholar 

  26. Hamid HM, Abdalla SE, Sidig M, Adam I, Hamdan HZ. Association of VEGFA and IL1β gene polymorphisms with preeclampsia in Sudanese women. Mol Genet Genomic Med. 2020;8(3):e1119-e.

  27. Pennington KA, Schlitt JM, Jackson DL, Schulz LC, Schust DJ. Preeclampsia: multiple approaches for a multifactorial disease. Dis Model Mech. 2012;5(1):9–18.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Attia ZI, El-Baz RA, Hassan HM, Abu-mosallam HM. Vascular Endothelial Growth Factor (VEGF) C/G 405, C/A 2578, AND C/T 936 gene polymorphisms in cases with Pre-eclampsia. Egypt J Exp Biol (Zoology). 2017;13(2):257–64.

    Google Scholar 

  29. Papazoglou D, Galazios G, Koukourakis MI, Panagopoulos I, Kontomanolis EN, Papatheodorou K, et al. Vascular endothelial growth factor gene polymorphisms and pre-eclampsia. Mol Hum Reprod. 2004;10(5):321–4.

    Article  CAS  PubMed  Google Scholar 

  30. Cheng D, Hao Y, Zhou W, Ma Y. Vascular endothelial growth factor +936C/T, –634G/C, –2578C/A, and –1154G/A polymorphisms with risk of preeclampsia: a meta-analysis. PLoS ONE. 2013;8(11): e78173.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Kulkarni AV, Mehendale SS, Yadav HR, Kilari AS, Taralekar VS, Joshi SR. Circulating angiogenic factors and their association with birth outcomes in preeclampsia. Hypertens Res. 2010;33(6):561–7.

    Article  CAS  PubMed  Google Scholar 

  32. Procopciuc LM, Caracostea G, Zaharie G, Stamatian F. Maternal/newborn VEGF-C936T interaction and its influence on the risk, severity and prognosis of preeclampsia, as well as on the maternal angiogenic profile. the journal of maternal-fetal & neonatal medicine : the official journal of the European association of perinatal medicine, the Federation of Asia and Oceania perinatal societies, the International society of perinatal obstet. J Matern Fetal Neonatal Med. 2014;27(17):1754–60.

    Article  CAS  PubMed  Google Scholar 

  33. Galazios G, Papazoglou D, Tsikouras P, Kolios G. Vascular endothelial growth factor gene polymorphisms and pregnancy. The journal of maternal-fetal & neonatal medicine : the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstet. 2009;22(5):371–8.

    Article  CAS  Google Scholar 

  34. Bezerra PC, Leão MD, Queiroz JW, Melo EM, Pereira FV, Nóbrega MH, et al. Family history of hypertension as an important risk factor for the development of severe preeclampsia. Acta Obstet Gynecol Scand. 2010;89(5):612–7.

    Article  PubMed  Google Scholar 

  35. Roten LT, Thomsen LCV, Gundersen AS, Fenstad MH, Odland ML, Strand KM, et al. The Norwegian preeclampsia family cohort study: a new resource for investigating genetic aspects and heritability of preeclampsia and related phenotypes. BMC Pregnancy Childbirth. 2015;15(1):319.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Wu C-T, Kuo C-F, Lin C-P, Huang Y-T, Chen S-W, Wu H-M, et al. Association of family history with incidence and gestational hypertension outcomes of preeclampsia. Int J Cardiol Hypertens. 2021;9:100084.

  37. Nakimuli A, Chazara O, Hiby SE, Farrell L, Tukwasibwe S, Jayaraman J, et al. A <i>KIR B</i> centromeric region present in Africans but not Europeans protects pregnant women from pre-eclampsia. Proc Natl Acad Sci. 2015;112(3):845–50.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13(1):134.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Stevenson M, Nunes T, Heuer C, Marshall J, Sanchez J, Thornton R, et al. epiR: An R package for the analysis of epidemiological data. . R package version 0.9–69 ed2015.

  40. Rausch T, Fritz MH-Y, Untergasser A, Benes V. Tracy basecalling, alignment, assembly and deconvolution of sanger chromatogram trace files. BMC Genomics. 2020;21(1):230.

    Article  PubMed  PubMed Central  Google Scholar 

  41. GitHub. [Available from: (https://github.com/samtools/bcftools).

  42. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, et al. The variant call format and VCFtools. Bioinformatics. 2011;27(15):2156–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Wickham H. ggplot2: Elegant Graphics for Data Analysis. 1 ed: Springer-Verlag New York; 2016.

Download references

Acknowledgements

We acknowledge the support given by Edgar Kigozi on behalf of the Medical and Molecular Laboratory, College of Health Sciences, Makerere University, Kampala, Uganda, towards administration of study laboratory events, optimisation and performing of laboratory assays, and shipping of generated PCR products to sequencing company. We recognise the support provided by the study team, including; Maxine Atuheirwe, Rosemary Byenkya, Margaret Sewagaba, Elizabeth Mutesi, Ruth Namubiru, Emily Nakirijja, Moreen Ahimbisibwe, Florence Walabyeki, Noela Kalyowa, Rita Kukundakwe, and Doreen Birungi.

Funding

The study was supported by the Makerere University-Uganda Virus Research Institute Centre of Excellence for Infection and Immunity Research and Training (MUII) (https://www.muii.org.ug) through a PhD grant to SN and a group leader award on Maternal and New-born Health to AN. MUII is supported through the DELTAS Africa Initiative (https://www.aasciences.africa/aesa/programmes/developing-excellence-leadership-training-and-science-africa-deltas-africa) (Grant no. 107743). The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS), Alliance for Accelerating Excellence in Science in Africa (AESA), and supported by the New Partnership for Africa's Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Wellcome Trust (https://wellcome.ac.uk) (Grant no. 107743) and the UK Government. AN is also supported a NURTURE fellowship (grant number D43TW010132). NM is funded by the Wellcome trust (grant number 204464/Z/16/Z).

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The content of this publication is the responsibility of the authors.

Author information

Authors and Affiliations

  1. Department of Medical Microbiology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, Uganda

    Sheila Nabweyambo & Freddie Bwanga

  2. The African Center of Excellence in Bioinformatics and Data-Intensive Sciences, Infectious Diseases Institute, Makerere University, Kampala, Uganda

    Stephen Kanyerezi & Gerald Mboowa

  3. Department of Immunology and Molecular Biology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, Uganda

    Stephen Kanyerezi, Alfred Ssekagiri, Savannah Mwesigwa, Gerald Mboowa & Obondo James Sande

  4. Department of Medical Biochemistry and Microbiology, Zoonosis Science Center, University of Uppsala, Uppsala, Sweden

    John H.-O. Petterson

  5. Clinical Microbiology and Hospital Hygiene, Uppsala University Hospital, Uppsala, Sweden

    John H.-O. Petterson

  6. Sydney Institute for Infectious Diseases, School of Life and Environmental Sciences and School of Medical Sciences, the University of Sydney, Sydney, Australia

    John H.-O. Petterson

  7. Medical and Molecular Laboratory, College of Health Sciences, Makerere University, Kampala, Uganda

    Fred Ashaba Katabazi & Faith Nakazzi

  8. Uganda Virus Research Institute, Entebbe, Uganda

    Alfred Ssekagiri

  9. Department of Obstetrics and Gynaecology, Kawempe National Referral Hospital, Kampala, Uganda

    Annette Keesiga & Annettee Nakimuli

  10. Department of Obstetrics and Gynaecology, School of Medicine, College of Health Sciences, Makerere University, Kampala, Uganda

    Moses Adroma & Annettee Nakimuli

  11. Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge, UK

    Naomi McGovern

Authors
  1. Sheila Nabweyambo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Stephen Kanyerezi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. John H.-O. Petterson
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Fred Ashaba Katabazi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Alfred Ssekagiri
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Savannah Mwesigwa
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Gerald Mboowa
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Faith Nakazzi
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Annette Keesiga
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Moses Adroma
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Freddie Bwanga
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Naomi McGovern
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Obondo James Sande
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Annettee Nakimuli
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

AN, SN, OJS, NM and FB: study conceptualization, proposal write up, review and editing, and investigation. AN: funding acquisition. AN, SN, FB, JH.-OP, OJS, NM, FAK; study methods development. AN, SN, AK and MA: study administration, enrolling study participants, data and sample collection. SN, FAK, and FN: optimisation and performing of study laboratory assay procedures. SN, SK, SM and GM: interpretation and analysis of laboratory generated data. AS and SK: formal statistical analyses. SN, AN and SK: writing original draft of the manuscript. AN, SN, OJS, FB, NM, JH.-OP, SK, FAK, FN: critical review of subsequent manuscript drafts. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Sheila Nabweyambo.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the Declaration of Helsinki, and approved by the Makerere University School of Biomedical Sciences Higher Degrees Research and Ethics Committee (REF: SBS-HDREC-617), and the Uganda National Council for Science and Technology (REF: HS 2535). Written informed consent was obtained from all subjects or legally authorised representatives/witnesses (for illiterate individuals) before participation in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

Supplementary Figure S1. Distribution of family history of hypertension among genotypes of the of the +936C/T polymorphism in cases and controls.

Additional file 2.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Nabweyambo, S., Kanyerezi, S., Petterson, J.HO. et al. No association of a Vascular endothelial growth factor A (VEGFA) gene polymorphism with pre-eclampsia among pregnant women in Uganda. BMC Genomics 24, 132 (2023). https://0-doi-org.brum.beds.ac.uk/10.1186/s12864-023-09213-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12864-023-09213-8

Keywords

BMC Genomics

ISSN: 1471-2164

Contact us