Skip to main content

Table 3 Predicted Brachypodium miRNAs that are responsive to cold stress.

From: Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response

Name Sequence (5'-3') L (nt) Arm/nt N Location in the genome AMFE
(kcal mol-1)
CD
NC/WC
miR901T UAUGCCAUGUCGUCACAUAUC 21 5'/104 1 super_0:10573853-10573873 -63.46 3/24
miR902T UAGAUCUUUAAAUAAACGGAUG 22 5'/174 1 super_1:13020674-13020695 -49.71 4/22
miR903T GGGGAAAAGAGAUUGAGGGAG 21 3'/92 1 super_0:36361618-36361638 -69.34 6/31
miR904T UGUUCAUACGGUUGAUAGCAC 21 3'/144 1 super_11:5086279-5086299 -47.71 3/22
miR905T UUCUUUGACCGAGCCUUUGAC 21 5'/140 1 super_4:26389353-26389373 -38.71 7/39
miR906T UGGACUGCAGGUUUAUUUCGG 21 3'/116 1 super_10:314839-314859 -41.15 4/23
miR910T UGUAGAUACUCUCUAAGGCUU 21 3'/87 1 super_1:8100215-8100235 -54.13 28/5
miR911T AAGAAUUUAGGGACGGAGGGA 21 3'/86 2 super_277:408-428 -70.01 35/4
    3'/88   super_2:20949532-20949552 -45.00  
miR912T ACUGGAUGGCACGGGAGCUAC 21 3'/103 1 super_4:17219372-17219392 -39.22 67/7
miR913T UUUGAACUAAGAAGGGUCAAA 21 3'/128 3 super_1:16079568-16079588 -44.14 43/5
    3'/131   super_3:15856277-15856297 -50.91  
    3/132   super_7:14469193-14469213 -57.34  
miR914T UUGAGCUAAGGAGGGUUGGAG 21 3'/100 1 super_11:2194743-2194763 -52.60 37/6
miR915T UUGAACUAAGGAGGGUCAAUG 21 3'/103 1 super_0:16172946-16172966 -71.94 29/5
miR916T AGGGCGAGGCAAAUGAUCAAA 21 3'/90 1 super_4:13613574-13613594 -66.22 33/6
miR917T ACUUAUUUCGGGACGGAGGGC 21 3'/88 1 super_10: 6143242-6143262 -58.75 34/6
miR918T AAAAUCGAGUAGCAGUCCGCG 21 3'/184 1 super_4:2249267-2249287 -40.59 41/5
miR919T AAAAUCGAGUAGCAGCCCGUG 21 3'/185 1 super_1:24396584-24396604 -58.75 144/28
miR920T AUCUUGGGCUCUAGGUAGGUU 21 5'/170 1 super_7:15735308-15735328 -58.58 25/5
miR921T UUUCGGCUUCUAGGACCGGCU 21 5'/203 1 super_5:18782230-18782250 -54.33 15/3
miR922T ACUUGUUUUGGGACGGAGGGA 21 3'/88 1 super_1: 22691473-22691493 -75.91 22/4
miR923T UUAGGUGCUUUCGGCUUUGGC 21 5'/116 1 super_0:7108639-7108659 -57.16 32/6
miR924T AGUAAUAUGUGUCGGAGGGGG 21 3'/100 1 super_5:7860249-7860269 -58.20 32/5
miR925T UUACGUGAGUUAAAUCGUCGA 21 3'/100 1 super_0:9973530-9973550 -64.40 16/3
miR926T AAGAAUUUAGGAAUGGAGGGA 21 3'/86 1 super_1:26695542-26695562 -45.58 36/6
miR927T AGAAUUUAGGGAAGGAGGGAU 21 3'/88 1 super_0:27230875-27230895 -56.93 37/7
miR928T ACUUAUUAUGGACCGGAGGGA 21 3'/71 1 super_3:10319482-10319502 -53.80 24/3
  1. Name, the name of predicted cold-responsive Brachypodium miRNAs and underlines denote miRNAs whose miRNA* have been detected in Solexa sequencing analysis; Sequence, sequence cloned in small RNA libraries; L, the length of miRNA; Arm/nt, the miRNA location in the predicted hairpin structure (5' or 3' arm)/the length of the precursor; N, number of loci in the genome; Location, miRNA location in the genome; AMFE, the adjusted minimum free energy (MFE) representing the MFE of 100 nucleotides, it is calculated by (MFE ÷ length of miRNA precursor sequence)× 100; CD, the effect of cold-treatment on miRNA expression, NC/WC, normalized sequencing frequencies in the NC and WC library.