Table 4 Selection of species-specific primers for PCR reaction
Taxa | Primer | Reference | Blast against BIN collection (number of identities) |
|---|---|---|---|
V. campbellii | Vca-hly-5: CTATTGGTGGAACGCAC (17) | V. campbellii (BIN 1): F: 17/17 R: 19/19 E. norvegicus (BIN 2): F: 14/14 R: 13/13 K. pneumoniae (BIN 3): F: 16/17 R: 13/19 | |
Vca-hly-3: GTATTCTGTCCATACAAAC (19) | |||
K. pneumoniae | KP878-F: ACCGATAACCAGCCTGACTT (20) | [77] | V. campbellii (BIN 1): F: 14/20 R: 13/20 E. norvegicus (BIN 2): F: 14/20 R: 13/20 K. pneumoniae (BIN 3): F: 20/20 R: 20/20 |
KP878-R: CTTTCTTCTGCCCACTGTTG (20) |